Analyze your data Home Help Citations Job Queue Stats HyPhy package
Navigation Banner
Datamonkey automatically recognizes five aligned sequence data formats and also autodetects whether the data is nucleotide (codon) or aminoacid. The recognized formats are:

Here are some small example file for each format, with a tree string present in the file.

FASTA Sequential.
>a 
ATGATTCAACCTCAGACCCTTTTAAATGTAGCAGATAACAGTGGAGCTCGAAAATTGATG
>b 
ATGATTCAACCTCAGACCCATTTAAATGTAGCGGATAACAGCGGGGCTCGAGAATTGATG
>og 
ATGATTCAACCTCAAACTTATTTAAATGTTGCAGATAATAGTGGAGCTCGAAAACTAATG
((a,b),og);

# Interleaved. (Line Width 30, Gap Width 10)
#a
#b
#og

ATGATTCAAC CTCAGACCCT TTTAAATGTA
ATGATTCAAC CTCAGACCCA TTTAAATGTA
ATGATTCAAC CTCAAACTTA TTTAAATGTT

GCAGATAACA GTGGAGCTCG AAAATTGATG
GCGGATAACA GCGGGGCTCG AGAATTGATG
GCAGATAATA GTGGAGCTCG AAAACTAATG

((a,b),og);
PHYLIP Sequential.
3	60
a          ATGATTCAAC CTCAGACCCT TTTAAATGTA GCAGATAACA GTGGAGCTCG 
           AAAATTGATG 
b          ATGATTCAAC CTCAGACCCA TTTAAATGTA GCGGATAACA GCGGGGCTCG 
           AGAATTGATG 
og         ATGATTCAAC CTCAAACTTA TTTAAATGTT GCAGATAATA GTGGAGCTCG 
           AAAACTAATG 

1
((a,b),og);

PHYLIP Interleaved. (Line Width 30, Gap Width 10)
3	60 I
a           ATGATTCAAC CTCAGACCCT TTTAAATGTA
b           ATGATTCAAC CTCAGACCCA TTTAAATGTA
og          ATGATTCAAC CTCAAACTTA TTTAAATGTT
            GCAGATAACA GTGGAGCTCG AAAATTGATG
            GCGGATAACA GCGGGGCTCG AGAATTGATG
            GCAGATAATA GTGGAGCTCG AAAACTAATG
1
((a,b),og);

NEXUS.
#NEXUS
BEGIN TAXA;
	DIMENSIONS NTAX = 3;
	TAXLABELS
		'a' 'b' 'og' ;
END;
BEGIN CHARACTERS;
	DIMENSIONS NCHAR = 60;
	FORMAT
		DATATYPE = DNA
		GAP=-
		MISSING=?
	;
MATRIX
	'a'   ATGATTCAACCTCAGACCCTTTTAAATGTAGCAGATAACAGTGGAGCTCGAAAATTGATG
	'b'   ATGATTCAACCTCAGACCCATTTAAATGTAGCGGATAACAGCGGGGCTCGAGAATTGATG
	'og'  ATGATTCAACCTCAAACTTATTTAAATGTTGCAGATAATAGTGGAGCTCGAAAACTAATG;
END;
BEGIN TREES;
	TREE tree = ((a,b),og);
END;
UCSD Viral Evolution Group 2004-2017  
Datamonkeys Webcomic New! Spidermonkey. HyPhy Package Page Datamonkey.org start page